IB Biology SL Evolution & Speciation Paper 1 & 2 Core idea ~11 min read

Evidence for Evolution

Nobody watched a fish turn into a frog, so how do we know evolution happened? The honest answer is that we do not rely on one killer piece of proof. We rely on several completely separate kinds of evidence — DNA, bones, and breeding experiments we ran ourselves — that all point to the same story.

📚 What you need to know

Evidence 1: sequence data

Every living thing stores its instructions in the same four-letter DNA code. That is already a hint. But the real evidence comes from comparing the actual order of those letters between species.

You can compare three kinds of sequence, and they all tell you the same thing:

The rule everything rests on More similar sequences → fewer changes have built up → a more recent common ancestor

Why we use “conserved” sequences

You cannot just grab any bit of DNA from two species and compare it. Scientists deliberately pick highly conserved regions: stretches of DNA that have changed very little over enormous spans of time, usually because they code for something essential like haemoglobin or a respiratory enzyme. Change those and the organism does not survive to reproduce.

🤔 Why conserved regions and not any old gene?

Three reasons, and examiners like all three. First, you must compare like with like — lining up two unrelated stretches of DNA tells you nothing. Second, because conserved regions change slowly, there are few differences, so each one stands out and can be counted. Third, conserved sequences are found in a wide range of species, so the same gene can be used to compare a bacterium, a mushroom and a whale.

Counting differences builds the family tree The same conserved gene in three species. Red letters are bases that differ from species A. SPECIES A ATGCCTGAAGGCATTCGTAAGCTGATCA SPECIES B ATGCCCGAAGGCATTCGTAGGCTGATCA SPECIES C AAGCGTGCAGTCACTCATATGCGGAGCA A vs B: 2 differences A vs C: 9 differences B vs C: 10 differences common ancestor Species A Species B Species C Fewest differences means the most recent shared ancestor. A and B split from each other recently. C branched off much earlier, so it has had longer to change.
Read the tree from left to right as time passing. The point where two lines meet is the last ancestor those species shared. Notice B and C differ the most, which fits: they have both been changing since the earliest split.
A real number worth quoting: when the chimpanzee genome was sequenced in 2005 and lined up against ours, roughly 99% of the sequence matched. That is the strongest single reason chimpanzees are called our closest living relatives.
Biologists never rely on a single gene. They compare several different genes from the same pair of species, because one odd gene could mislead you. Agreement across many genes is what makes the conclusion trustworthy.

Evidence 2: selective breeding

This one is powerful because humans did it on purpose and wrote it down. In selective breeding (also called artificial selection) we pick the individuals with the characteristics we want and breed them together, over and over.

🧩 The process, in five steps

  1. Variation exists. The starting population already contains individuals with different characteristics.
  2. Select. The breeder picks the individuals showing the desired characteristic most strongly.
  3. Breed. Those chosen individuals are bred together.
  4. Test the offspring. When the offspring mature, check which ones show the characteristic best.
  5. Repeat over many generations until the whole population shows it.

Look at that list again and compare it with natural selection. The only thing that changed is who does the choosing. In nature the environment decides who breeds; in selective breeding a farmer decides.

NATURAL SELECTION

  • The environment selects
  • Alleles that aid survival spread
  • Slower — less-suited individuals still breed sometimes
  • No goal or plan

SELECTIVE BREEDING

  • Humans select
  • Alleles humans find useful spread
  • Faster — only chosen individuals are allowed to breed
  • A clear goal, e.g. more milk

Why does this count as evidence? Because it proves the mechanism works. A single wild cabbage-like plant has been bred into cabbage, cauliflower, broccoli, kale, kohlrabi and Brussels sprouts — all still the same species, all looking wildly different, and all produced by selecting on natural variation. If small heritable changes can pile up that far in a few centuries, it is not a stretch to accept what millions of years could do.

Evidence 3: homologous structures

Homologous structures are body parts that may look completely different and do completely different jobs, but are built to the same underlying plan.

Definition Homologous structures = same basic structure, different function, inherited from a common ancestor

The classic case is the pentadactyl limb — any limb with five digits. Look at a human arm, a whale flipper, a bat wing and a bird wing. They are used for completely different things, yet the bones inside are laid out in the same order every time: one long upper bone, then two bones side by side, then a cluster of small wrist bones, then digits.

Four very different limbs, one shared bone plan Same colour means the same bone. Only the lengths and thicknesses change. upper arm bone two lower bones wrist bones digits HUMAN ARM WHALE FLIPPER BAT WING BIRD WING Grasping, swimming, flapping, gliding — but always the same bones in the same order. A shared ancestor explains this neatly. Four separate designs would not all land on the same layout.
If each of these limbs had been designed from scratch for its job, there is no reason a whale flipper would need finger bones inside it. The layout only makes sense as something inherited and then reshaped.

Adaptive radiation

The usual explanation for homologous structures is adaptive radiation: one ancestral species spreads out into different habitats, and natural selection reshapes the same body parts for different lives. Wrist bones become part of a paddle in the sea, and finger bones stretch into a wing frame in the air.

Be precise: adaptive radiation does not prove a common ancestor. It is the best available explanation for a pattern we can see. IB likes you to be careful with words like “prove”.

Worked examples

WORKED EXAMPLE

Three species were compared for the same gene. A and B differ at 2 bases, A and C at 9, and B and C at 10. Which two species are most closely related, and explain your reasoning. [3]

Step 1: find the smallest number of differences A vs B = 2, which is the lowest of 2, 9 and 10 Species A and B are the most closely related Step 2: explain what the number means Base differences build up by mutation after two species separate. Fewer differences means less time has passed since they shared an ancestor. Step 3: place C C differs a lot from both, so it branched off earlier and is the more distant relative.
WORKED EXAMPLE

Explain why scientists compare highly conserved DNA sequences rather than randomly chosen ones. [3]

Point 1 Conserved sequences are present in a wide range of species, so the same region can be found in all of the organisms being compared. Point 2 You must compare the same region in each species. Comparing unrelated stretches of DNA gives meaningless results. Point 3 Conserved regions change slowly, so there are few differences and each one can be identified and counted clearly. Same region, present everywhere, few enough differences to count
WORKED EXAMPLE

Explain how selective breeding provides evidence for evolution. [3]

Step 1: show it fits the definition Selective breeding changes heritable characteristics of a population over many generations, which is exactly what evolution means. Step 2: name the mechanism It works on naturally occurring variation, and desirable alleles become more frequent because only chosen individuals breed. Step 3: draw the conclusion It shows small changes in DNA can accumulate into large differences, and we can watch it happen Add the cabbage example if the question says “using an example”.

💡 Exam tip

⚠ Common mix-up

Up next: Convergent Evolution — what happens when two unrelated species end up looking almost identical, and how DNA lets us catch the coincidence.

Want this explained one-to-one?

Book a free session with an experienced IB Biology tutor and get your trickiest topics made simple.

Book a Free Session →